View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4225_high_16 (Length: 249)
Name: NF4225_high_16
Description: NF4225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4225_high_16 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 41901571 - 41901337
Alignment:
| Q |
18 |
gatcttctatttcatttcttcccttttttcctctttaaatttgattaattacttgatcttaaactgtatcctttttattgtaattgataattaggcataa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41901571 |
gatcttctatttcatttcttcccttttttcctctttaaatttgattaattacttgatcttaaactgtatcctttttattgtaattaataattaggcataa |
41901472 |
T |
 |
| Q |
118 |
tattgatgatgctttagcctgtgccattggagaattgaaaaacaagctactatttgtttgggttcgtatactcgcttatgctgtaatatacataaa---a |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
41901471 |
tattgatgatgctttagcctgtgccatcggagaattgaaaaacaagctactatttgtttgggttcgtatactcgcttatgctgttttatacataaaatca |
41901372 |
T |
 |
| Q |
215 |
tttcctaacaactctattcgttaattaatgtgttt |
249 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
41901371 |
tttcctaataactctattcgttaattaatgtgttt |
41901337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 113 - 180
Target Start/End: Complemental strand, 41896461 - 41896394
Alignment:
| Q |
113 |
cataatattgatgatgctttagcctgtgccattggagaattgaaaaacaagctactatttgtttgggt |
180 |
Q |
| |
|
|||||| |||||| ||||||||| ||||| ||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
41896461 |
cataatgttgatggtgctttagcatgtgctattggcgattcgaaaaacaagctactatttgtttgggt |
41896394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University