View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4225_high_17 (Length: 245)

Name: NF4225_high_17
Description: NF4225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4225_high_17
NF4225_high_17
[»] scaffold0136 (1 HSPs)
scaffold0136 (1-228)||(25933-26161)
[»] chr7 (1 HSPs)
chr7 (119-175)||(30220263-30220319)
[»] chr5 (1 HSPs)
chr5 (119-175)||(17629570-17629626)
[»] chr3 (1 HSPs)
chr3 (119-175)||(32020661-32020717)


Alignment Details
Target: scaffold0136 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: scaffold0136
Description:

Target: scaffold0136; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 25933 - 26161
Alignment:
1 ccatactatgagtaagcatagagtgaatgactgatttgactaacaaagttctaccagatattgataataaagaagcatgccaagagttaa-gctttaatc 99  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||    
25933 ccatactatgagtaaacatagagtgaatgactgatttgactaacaaagttctaccagatattgataatagagaagcatgccaagagttaaagctttaatc 26032  T
100 tgattctgtctgctatggattgaagatgagaagctttaggtttccctttaaagattggcacccccaagtaattgaatggaagctgaccagagttgaaacc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26033 tgattctgtctgctatggattgaagatgagaagctttaggtttccctttaaagattggcacccccaagtaattgaatggaagctgaccagagttgaaacc 26132  T
200 aagtaaattgacaatatgagataacctac 228  Q
    |||||||||||||||||||||||||||||    
26133 aagtaaattgacaatatgagataacctac 26161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 175
Target Start/End: Complemental strand, 30220319 - 30220263
Alignment:
119 ttgaagatgagaagctttaggtttccctttaaagattggcacccccaagtaattgaa 175  Q
    ||||||||||||| |||| ||||||||| | || || ||||||||||| ||||||||    
30220319 ttgaagatgagaaacttttggtttccctctgaaaataggcacccccaaataattgaa 30220263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 175
Target Start/End: Original strand, 17629570 - 17629626
Alignment:
119 ttgaagatgagaagctttaggtttccctttaaagattggcacccccaagtaattgaa 175  Q
    ||||||||||||| |||| ||||||||| | || || ||||||||||| ||||||||    
17629570 ttgaagatgagaaacttttggtttccctctgaaaataggcacccccaaataattgaa 17629626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 175
Target Start/End: Complemental strand, 32020717 - 32020661
Alignment:
119 ttgaagatgagaagctttaggtttccctttaaagattggcacccccaagtaattgaa 175  Q
    ||||||||||||| |||| ||||||||| | || || ||||||||||| ||||||||    
32020717 ttgaagatgagaaacttttggtttccctctgaaaataggcacccccaaataattgaa 32020661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University