View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4225_high_23 (Length: 227)
Name: NF4225_high_23
Description: NF4225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4225_high_23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 32852646 - 32852420
Alignment:
| Q |
1 |
taaaattaaaattcaagatagtttagtttggtaacatacaatacaatgcttattttggcctgtgttatttaatatattcatattgttgcctaaaacttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852646 |
taaaattaaaattcaagatagtttagtttggtaacatacaatacaatgcttattttggcttgtgttatttaatatattcatattgttgcctaaaacttgc |
32852547 |
T |
|
| Q |
101 |
tttcatcatgatttgataatactgcaaataatccagaaaatatggtagtcatgttctgcattaatcatgttcacattgttaaggaattgaattcatgagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32852546 |
attcatcatgatttgataatactgcaaataatccagaaaatatggtagtcatgttctgcattaatcatgttcacattgttaaggaattgaattcatgagc |
32852447 |
T |
|
| Q |
201 |
ttaaatgacgacaatgcaaactagcct |
227 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
32852446 |
ttaaatgacgacattgcaaactagcct |
32852420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University