View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4225_high_24 (Length: 215)
Name: NF4225_high_24
Description: NF4225
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4225_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 34 - 199
Target Start/End: Original strand, 9626708 - 9626871
Alignment:
| Q |
34 |
tatatcatgtcttgtatgaaattattccaatggtcacaccacttataatgtggtccgctttcatcaaactgtctctcctgccaacatccctttgcggata |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9626708 |
tatatcatgtcttgtatgaaattattccaatggtcac--cacttataatgtggtccgctttcatcaaactgtctgtcctgccaacatccctttgcggata |
9626805 |
T |
 |
| Q |
134 |
ccattattggggtatcnnnnnnnnnngaaagaattattattggggtatctattctgtcctgttcat |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
9626806 |
ccattattggggtatcttttttttttgaaagaattattattggggtatctatcctctcctgttcat |
9626871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University