View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226-Insertion-30 (Length: 268)
Name: NF4226-Insertion-30
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226-Insertion-30 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 8 - 268
Target Start/End: Complemental strand, 33300673 - 33300413
Alignment:
| Q |
8 |
cattgtgaacaaagatttctctatcatttttccatgtctccacgagatttatccgtaccggcgaattcacttctccagcaaagaaagctagctttttcct |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33300673 |
cattgtgaacaaagatttctgtatcatttttccatgtctccacaagatttatccgtaccggcgaattcacttctccagcaaagaaagctagctttttcct |
33300574 |
T |
 |
| Q |
108 |
gtcaaaatcaatgagttttacttttatatcatgtaataaaatcattgttgcaacgtttctttagaaaaaactttaattgcagtttcggtccgcctatttt |
207 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33300573 |
gtcaaaatcaatgaattttacttttatatcatgtaataaaatcattgttgcaacgtttctttagaaaaaaatttaattgcagtttcggtccgcctatttt |
33300474 |
T |
 |
| Q |
208 |
taattactaacggagttggtcctctattaatttaaaatctagttttttgttgtctagttca |
268 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33300473 |
taattactaacggggttggtcctctattaatttaaaatctagttttttgttgtctagttca |
33300413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University