View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226-Insertion-32 (Length: 262)
Name: NF4226-Insertion-32
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226-Insertion-32 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 10 - 262
Target Start/End: Complemental strand, 26496489 - 26496237
Alignment:
| Q |
10 |
aagttgttttcggcttataaattatatgaaaacagcttatagtttatgaaaacagtttataacttcatgaactcaatttgattatatttatccattgtta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496489 |
aagttgttttcggcttataaattatatgaaaacagcttatagtttatgaaaacagtttataacttcatgaactcaatttgattatatttatccattgtta |
26496390 |
T |
|
| Q |
110 |
tagaacacttatatgacaagcgcttatgctataagttcaattatgtttatccaaataggcccttaatctcttattattaactaatgaagccattattcat |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496389 |
tagatcacttatatgacaagcgcttatgctataagttcaattaagtttatccaaataggccctgaatctcttattattaactaatgaagccattattcat |
26496290 |
T |
|
| Q |
210 |
tgtgtttacaaatgatattgtttgttcaggtaggaacttttgcaagtctggta |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496289 |
tgtgtttacaaatgatattgtttgttcaggtaggaacttttgcaagtctggta |
26496237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 33 - 69
Target Start/End: Complemental strand, 41170620 - 41170584
Alignment:
| Q |
33 |
atatgaaaacagcttatagtttatgaaaacagtttat |
69 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
41170620 |
atatgaaaacagcttatagcttatgaaaatagtttat |
41170584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University