View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226-Insertion-38 (Length: 211)
Name: NF4226-Insertion-38
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226-Insertion-38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 211
Target Start/End: Complemental strand, 4389439 - 4389235
Alignment:
| Q |
8 |
gcagaagcattttcaactttcaacatacttcataggctatccttatcactttctcgagacagcaaatg-catcacaccataaagaatcgatcttcaatga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4389439 |
gcagaagcattttcaactttcaacatacttcataggctatccttatcactttctcgagacagcaaatggcatcacaccataaagaatcgatcttcaatga |
4389340 |
T |
 |
| Q |
107 |
atggcatgagttttgtgtgaaccaaaactctagccgactccatagataaccctttctccacctctacatgatcaatctttcctatcttatcaataacaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4389339 |
atggcatgagttttgtgtgaaccaaaactctagctgactccatagataaccctttctccacctctacatgatcaatctttcctatcttatcaataacaag |
4389240 |
T |
 |
| Q |
207 |
ttcca |
211 |
Q |
| |
|
||||| |
|
|
| T |
4389239 |
ttcca |
4389235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University