View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226-Insertion-42 (Length: 188)
Name: NF4226-Insertion-42
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226-Insertion-42 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 8 - 188
Target Start/End: Complemental strand, 4716719 - 4716539
Alignment:
| Q |
8 |
gatgatatgttgctttgcaattgcccattttctgtagatgcccttcattggaccgtcaaatatgacatatgcttcaaacattcccatttcattgtctacg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4716719 |
gatgatatgttgctttgcaattgcccattttctgtagatgcccttcattggaccgtcaaatatgacatatgcttcaaacattcccatttcattgtctacg |
4716620 |
T |
|
| Q |
108 |
agatcgcttatttggatggttgaaccattttttcttgcttcatcttcttcttcgacttcttcagcccatgattttttgttg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4716619 |
agatcgcttatttggatggttgaaccattttttcttgcttcatcttcttcttcgacttcttcagcccatgattttttgttg |
4716539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 185
Target Start/End: Complemental strand, 41616403 - 41616226
Alignment:
| Q |
8 |
gatgatatgttgctttgcaattgcccattttctgtagatgcccttcattggaccgtcaaatatgacatatgcttcaaacattcccatttcattgtctacg |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||| ||||| |||||| |
|
|
| T |
41616403 |
gatgatatgttgttttgcaattgcccattttctgtagatgcccttcattggaccgtcgaaaatgacatatgcttcaaactttcccatatcattatctacg |
41616304 |
T |
|
| Q |
108 |
agatcgcttatttggatggttgaaccattttttcttgcttcatcttcttcttcgacttcttcagcccatgattttttg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41616303 |
agatcgcttatttggatggttgaaccattttttcttgcttcatcttcttcttcaacttcttcagcccatgattttttg |
41616226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 8 - 188
Target Start/End: Complemental strand, 2620233 - 2620052
Alignment:
| Q |
8 |
gatgatatgttgctttgcaattgcccattttctgtagatgcccttcattggaccgtcaaatatgacatatgcttcaaacattcccatttcattgtctacg |
107 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
2620233 |
gatgacatgttgttttgcaattgcccattttctgtagatgcccttcattggaccgtcgaaaatgacatatgcttcaaactttcccatttcattatctacg |
2620134 |
T |
|
| Q |
108 |
agatcgcttatttggatggttgaaccatt-ttttcttgcttcatcttcttcttcgacttcttcagcccatgattttttgttg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2620133 |
agatcgcttatttggatggttgaaccatttttttcttgcttcatcttcttcttcaacttcttcagcccatgattttttgttg |
2620052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 9 - 182
Target Start/End: Original strand, 22427112 - 22427285
Alignment:
| Q |
9 |
atgatatgttgctttgcaattgcccattttctgtagatgcccttcattggaccgtcaaatatgacatatgcttcaaacattcccatttcattgtctacga |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||| | |||||||||||||| || |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22427112 |
atgatatgttgttttgcaattgcccattttctatagatgtctttcattggaccgtcgaaaatgacatatgcttcaaactttcccatttcattgtctacgt |
22427211 |
T |
|
| Q |
109 |
gatcgcttatttggatggttgaaccattttttcttgcttcatcttcttcttcgacttcttcagcccatgatttt |
182 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
22427212 |
gatcgcttgtttggatggttgaatcattttttcttgcttcatcttcttcttcgacttcttcaacccaagatttt |
22427285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University