View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226-Insertion-50 (Length: 91)
Name: NF4226-Insertion-50
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226-Insertion-50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.000000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 30654491 - 30654535
Alignment:
| Q |
8 |
atttttaccatgacatccttcaagtatagccaataaatccgatca |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30654491 |
atttttaccatgacatccttcaagtatagccaataaattcgatca |
30654535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University