View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226_high_20 (Length: 201)
Name: NF4226_high_20
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 31056525 - 31056356
Alignment:
| Q |
18 |
ggcaatctggttcatgaaaaattcacccaatttattctcaactttggatatcgcacctttctttgaggagtaggaggtggaggt---nnnnnnnnnnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31056525 |
ggcaatctggttcatgaaaaattcacccaatttattctcaactttggatatcgcacctttctttgatgagtaggaggtggaggtagaagaagaagaagaa |
31056426 |
T |
 |
| Q |
115 |
nnnnctgcggctgatgttgatgccatggttctagaacccgacataacttctgcttcaagccacatgtaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31056425 |
gaagctgcggctgatgttgatgccatggttctagaacccgacataacttctgcttcaagccacatgtaag |
31056356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University