View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4226_high_8 (Length: 388)

Name: NF4226_high_8
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4226_high_8
NF4226_high_8
[»] chr7 (1 HSPs)
chr7 (296-376)||(30960763-30960843)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 5e-38; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 296 - 376
Target Start/End: Original strand, 30960763 - 30960843
Alignment:
296 gatagaataaaatattgtgaattgtttagaaatttcattttaattcaatcctatagctcaattatgtcttactaccattca 376  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30960763 gatagaataaaatattgtgaattgtttagaaatttcattttaattcaatcctatagctcaattatgtcttactaccattca 30960843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University