View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226_low_17 (Length: 332)
Name: NF4226_low_17
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 53678169 - 53677856
Alignment:
| Q |
1 |
tttaattttttcagcttttctcagaacttaattgctttgtacttttacttacaactcctaatttcattttcgttttctctcatcttaggaattatcgttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53678169 |
tttaattttttcagcttttctcagaacttaattgctttgtacttttacttactactcctaatttcattttcattttctctcatcttaggaattatcgttc |
53678070 |
T |
|
| Q |
101 |
cnnnnnnnactattctatttactctcctctcatttactagtactactttttctatctttcattctgctatttactcaaaccccaacggtaaaaacattct |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53678069 |
ctttttttactattctatttactctcctctcatttaccagtactactttttctatctttcattctgctatttactcaaaccacaacggtaaaaacattct |
53677970 |
T |
|
| Q |
201 |
tcaacttattaaattaaattttcaagcagttccggcgacgtgaactactaaaaatgtcatcatcggcggtgagaagcaagaactccggcgacgacgacga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53677969 |
tcaacttattaaattaaattttcaagcagttccggcgacgtgaactactaaaaatgtcatcatcggcggtgagaagcaagaactccggcaacgacgacga |
53677870 |
T |
|
| Q |
301 |
agccaaacactatc |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
53677869 |
agccaaacactatc |
53677856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University