View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226_low_31 (Length: 215)
Name: NF4226_low_31
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226_low_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 3 - 197
Target Start/End: Original strand, 2755649 - 2755845
Alignment:
| Q |
3 |
atctctgaatatatttaaatcacaaaaacatctttaaatatgtctttattagtaattttatgaactaaagtgtctaaaaatatatatattaatgacacat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2755649 |
atctctgaatatatttaaatcacaaaaacatctttaaatatgtctttattagtaattttatgaactaaagtgtctaaaactatatatattaatgacacat |
2755748 |
T |
|
| Q |
103 |
taaagttacaaatatttggcgat-nnnnnnnnntattgactaacaaaaaccatattaatgtaa-ttttttgtaattttgatgcattcggaaactatt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||| |||||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
2755749 |
taaagttacaaatatttggcgataaaaaaaaaatattgactaacaaaaacaatattgatgtaatttttttgtaattctgatgcattcagaaactatt |
2755845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University