View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4226_low_32 (Length: 210)
Name: NF4226_low_32
Description: NF4226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4226_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 6 - 187
Target Start/End: Original strand, 4090725 - 4090906
Alignment:
| Q |
6 |
gcatgtccaagaatatcagttgctagtcttagggaaagatttgaaaattttatgtcttcttttgaggtgtcatcaagattttgggttgctgattcgataa |
105 |
Q |
| |
|
|||| ||||| || |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4090725 |
gcatctccaataacatcagttgctagtcttagggaaagatttgaaaatattatgtcttcttttgaggtgtcatcaagattttgggttgctgattcaataa |
4090824 |
T |
|
| Q |
106 |
atgattgcattttaggcactgagttggctaaatgtgatggttggtatactgataatatggtatttctcattgtagaccattg |
187 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4090825 |
atgattgcattttaggcactaagttggctaagtgtgatggttggtatactgataatatggtatttctcatcgtagaccattg |
4090906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 187
Target Start/End: Complemental strand, 48182874 - 48182765
Alignment:
| Q |
78 |
tcaagattttgggttgctgattcgataaatgattgcattttaggcactgagttggctaaatgtgatggttggtatactgataatatggtatttctcattg |
177 |
Q |
| |
|
||||||||||| || || ||||| || |||||||||||| | |||||| | | | || ||||||||||| ||||| || |||||||| |||||||||| |
|
|
| T |
48182874 |
tcaagattttgagtggcagattctatgaatgattgcattgttggcactaatcttgataggtgtgatggttgatataccgacaatatggtgtttctcattg |
48182775 |
T |
|
| Q |
178 |
tagaccattg |
187 |
Q |
| |
|
|||||||||| |
|
|
| T |
48182774 |
tagaccattg |
48182765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University