View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4227_high_18 (Length: 291)
Name: NF4227_high_18
Description: NF4227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4227_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 266
Target Start/End: Complemental strand, 37244384 - 37244115
Alignment:
| Q |
2 |
agaataatatcaaccaacacttctatatagctataaacatcattgaataggaaaaataatggtatttgttatttattgaaatttgaatggtccttgatga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37244384 |
agaataatatcaaccaacacttctatatagccataaacatcattgaataggaaaaataatggtatttgttatttattgaaatttgaatggtccttcatga |
37244285 |
T |
|
| Q |
102 |
gtataaaaattcaaaggaaaatttgatgagtata------atgcttcaagtgtttgaataaactgttgaaacgagggtagatgggtaactagagggaggc |
195 |
Q |
| |
|
||||||||||||||||||||||||| || || | |||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
37244284 |
gtataaaaattcaaaggaaaatttg-tgtgtcaaaggggtatgcttcaagtggttgaataaactgttgaaacgagggtagacgggtaactaaagggaggc |
37244186 |
T |
|
| Q |
196 |
ttgaaaatctcacctacgaagaatgaagaccatcttttgatacgatgaaatcatcaaaatgtactttactc |
266 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37244185 |
ttgaaaatctcacctacgaaaaatgaagaccatcttttgatacgatgaaatcatcaaaatgtactttactc |
37244115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University