View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4227_high_20 (Length: 281)
Name: NF4227_high_20
Description: NF4227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4227_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 37619660 - 37619397
Alignment:
| Q |
1 |
tttacatttgtgcacttttaacaacatagcaatttactttttaaactcatttacatttcttgcacttcaagtttatgccagttgaccttcatttatttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37619660 |
tttacatttgtgcacttttaacaacatagcaatttactttttaaactcatttatatttcttgcacttcaagtttatgccagttgaccttcatttatttta |
37619561 |
T |
|
| Q |
101 |
ctttatgcaccgtacattttcaatgtattttttacattctttgcactttaaatttcaagatagttcattcgcaggcacgttttatgctcaaatcattcac |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37619560 |
ctttatgcactgtacattttcaatgtattttttagattctttgcactttaaatttcaagatagttcattcgcaggcacgttttatgctcaaatcattcac |
37619461 |
T |
|
| Q |
201 |
ttttctgcatcaaaatagttcatcattcgtattctcaatattaaacattctaatcatttataat |
264 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37619460 |
ttttctgcatcaaaatagttcattattcgtattctcaatattaaacattctaatcatttataat |
37619397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University