View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4227_high_23 (Length: 250)
Name: NF4227_high_23
Description: NF4227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4227_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 36942930 - 36942690
Alignment:
| Q |
1 |
gcatctttaccttcctttgtagcttgagaccatgcctgaattatagcatcaaaatatgtcagaagttctttagaatgacagagcttgtacccataattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942930 |
gcatctttaccttcctttgtagcttgagaccatgcctgaattatagcatcaaaatatgtcagaagttctttagaatgacagagcttgtacccataattga |
36942831 |
T |
 |
| Q |
101 |
acggtgttcaaggagtaatgcgacccactacagcctagagctctatgtctactgcgaccgttctaagttttgcaactaaacaaacaagcatcagtgctta |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942830 |
acagtgttcaaggagtaatgcgacccactacagcctagagctctatgtctactgcgactgttctaagttttgcaactaaacaaacaagcatcagtgctta |
36942731 |
T |
 |
| Q |
201 |
tgataataagtaaataccggatcatgaacaatgagaataat |
241 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36942730 |
tgataaaaagtaaataccggatcatgaacaatgagaataat |
36942690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University