View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4227_high_8 (Length: 422)
Name: NF4227_high_8
Description: NF4227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4227_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 17 - 413
Target Start/End: Complemental strand, 2735057 - 2734661
Alignment:
| Q |
17 |
aagaacaaggcacaaagaagaagttgcagagtctctacggggaaaataagtttcctaagaaggttcatatctaatttgattggcaagatgaagtcatttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2735057 |
aagaacaaggcacaaagaagaagttgcagagtctctacggggaaaataagtttcctaagaaggttcatatctaatttgattggcaagatgaagtcatttt |
2734958 |
T |
 |
| Q |
117 |
caccattgctaagactaaaggacttagagggaatgatatggggagccgaaaacataacacctttaagcaaatcaagtatgcctttgtgaatccaccagta |
216 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2734957 |
cacctttgttaagactaaaggacttagagggaatgatatggggagccgaaaacataacaccattaagcaaatcaagtaggcctttgtgaatccaccagta |
2734858 |
T |
 |
| Q |
217 |
ctcgtgccgctagtaccaggtaaaccggtaaaaatgtacattgtcgcaaaagatgagtcaatcgggttcttgctagcacaagatatcgatgatggaatgg |
316 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2734857 |
ctcgtgccactagtaccaggtaaaccggtaaagttgtacattgtcgcaaaagatgagtcaatcgggttcttgctagcacaagatatcgatgatggaatgg |
2734758 |
T |
 |
| Q |
317 |
acttagccgaatcttgaatgatgcttagactagatatacatccactgagaaattatttgtatcgctactttatgcttgcaacaaacttaagtattat |
413 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2734757 |
acttagtcgaatcttgaatgatgcttagactagatatacatccactgagaaattatttgtatcgctactctatgcttgcaacaaacttaagtattat |
2734661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University