View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4227_low_16 (Length: 345)
Name: NF4227_low_16
Description: NF4227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4227_low_16 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 96 - 345
Target Start/End: Original strand, 26511448 - 26511697
Alignment:
| Q |
96 |
gttgattctccattatgtgtcacacttggtatatcaaaaatagaagaaacaactagagacgtggatgtgatttgttttgttttgttgcatgttataagat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26511448 |
gttgattctccattatgtgtcacacttggtatatcaaaaatagaagaaacaactagagacgtggatgtgatttgttttgttttgttgcatgttataagat |
26511547 |
T |
|
| Q |
196 |
aatagaaatattgaaaaatctacatagcataaaaaagttgtggctgcaaattctctacaaattttcatgtatcccccactcaaccaatcctcgtcatttg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26511548 |
aatagaaatattgaaaaatctacatagcataaaaaagttgtggctgcaaattctctacaaattttcatgtatcccccactcaaccaatcctcgtcatttg |
26511647 |
T |
|
| Q |
296 |
ttctaatctctctctccttggacctttgtctcagtgtcactattttctca |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26511648 |
ttctaatctctctctccttggacctttgtctcagtgtcactattttctca |
26511697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University