View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4227_low_30 (Length: 227)
Name: NF4227_low_30
Description: NF4227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4227_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 62 - 149
Target Start/End: Original strand, 4143333 - 4143420
Alignment:
| Q |
62 |
actaagtttaaagaactttcaaattatataatccgaattttgtattgcccagatttaaataacagcaccaacctatagtattaagatg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
4143333 |
actaagtttaaagaactttcaaattatataatccgaattttgtattgcccagatttaaataacagcaccgacgtatagtattaagatg |
4143420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 65 - 149
Target Start/End: Original strand, 4159146 - 4159230
Alignment:
| Q |
65 |
aagtttaaagaactttcaaattatataatccgaattttgtattgcccagatttaaataacagcaccaacctatagtattaagatg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
4159146 |
aagtttaaagaactttcaaattatataatccgaattttgtattgcccagatttaaatagcagcaccgacgtatagtattaagatg |
4159230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 7 - 61
Target Start/End: Original strand, 4143233 - 4143287
Alignment:
| Q |
7 |
caaagaagttcttgtttcattattactttttccacgtgtcactcatgcgtactat |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
4143233 |
caaagaagttcttgtttcattattactttttccacgtgtctctcacgcgtactat |
4143287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 4159045 - 4159097
Alignment:
| Q |
9 |
aagaagttcttgtttcattattactttttccacgtgtcactcatgcgtactat |
61 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
4159045 |
aagaagtttttgtttcattattactttttccacatgtctctcacgcgtactat |
4159097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University