View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4228_high_11 (Length: 371)

Name: NF4228_high_11
Description: NF4228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4228_high_11
NF4228_high_11
[»] chr4 (2 HSPs)
chr4 (10-169)||(28645447-28645606)
chr4 (297-329)||(28645717-28645749)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 10 - 169
Target Start/End: Original strand, 28645447 - 28645606
Alignment:
10 gcagagaagaaagggttcgatcggaaaaaccctagaaaatcccgcggagatgccgcgggaggttgaagatgaattcagcggcggaggtgaaagggatttt 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
28645447 gcagagaagaaagggttcgatcggaaaaaccctagaaaatcccgcggagatgccgcgggaggttgaagatgaattcagcggcggaggtgagagggatttt 28645546  T
110 ggggaaattgagtgaaaatcgcaaaagattttgattttgtgagaatcgcttattgatcga 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28645547 ggggaaattgagtgaaaatcgcaaaagattttgattttgtgagaatcgcttattgatcga 28645606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 329
Target Start/End: Original strand, 28645717 - 28645749
Alignment:
297 gtaacaaataattcaattttatctttttccttc 329  Q
    |||||||||||||||||||||||||||| ||||    
28645717 gtaacaaataattcaattttatcttttttcttc 28645749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University