View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4228_high_13 (Length: 360)
Name: NF4228_high_13
Description: NF4228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4228_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 145 - 349
Target Start/End: Original strand, 10990407 - 10990627
Alignment:
| Q |
145 |
tatagcttcaatttattaggtgacgtaaaggttagaaaaagatgaagggaaaggtcccatgaaatcagtaccccgacaa----------------ccaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10990407 |
tatagcttcaatttattaggtgacataaaggttagaaaaagatgaagggaaaggtcccatgaaatcagtaccccgacaaccaaaagttccaatttccaaa |
10990506 |
T |
|
| Q |
229 |
atttcgtgtaggggcatctcannnnnnnnagcaatactgcttgttgatcaattttatctccatttgtaatggcctccatacgaagtactatggcaatgtt |
328 |
Q |
| |
|
|||||||||||| |||||||| |||||||| || ||||||||| ||||||||||||||||||||||||||||| |||| ||||||| |||||| |
|
|
| T |
10990507 |
atttcgtgtaggagcatctcattttttttagcaataccgcatgttgatcagttttatctccatttgtaatggcctccatatgaagaactatggaaatgtt |
10990606 |
T |
|
| Q |
329 |
acatgatgtccctttattctt |
349 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
10990607 |
agatgatgtccctttattctt |
10990627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 104; E-Value: 9e-52
Query Start/End: Original strand, 17 - 132
Target Start/End: Original strand, 10985245 - 10985360
Alignment:
| Q |
17 |
caattgtcaactcgtttaaagttgttatggtgtaaccaccttatgcttcacattgtattttgcaagaacactctccaatattgattacataaatgttttc |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10985245 |
caattgtcaactcgtttcaagttgttatggtgtaaccatcttatgcttcacattgtattttgcaagaacactctccaatattgattacataaatgttttc |
10985344 |
T |
|
| Q |
117 |
gtttgtcacttatcaa |
132 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
10985345 |
gtttgtcactgatcaa |
10985360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University