View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4228_high_4 (Length: 515)
Name: NF4228_high_4
Description: NF4228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4228_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-110
Query Start/End: Original strand, 34 - 267
Target Start/End: Complemental strand, 48562045 - 48561809
Alignment:
| Q |
34 |
aagaagaaggtattttcagcatttccaactcagaatttatgtaaagtatt---ccttaaaaagaatttacgtgaagttatgaaaaattgagaatacattg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48562045 |
aagaagaaggtattttcagcatttccaactcagaatttatgtaaagtattattccttaaaaagaatttacgtgaagttatgaaaaattgagaatacattg |
48561946 |
T |
 |
| Q |
131 |
ctttccaattcactgcacaacagcaataacccaagggcactagtcttgcacttccactctctccaagcaccacttttcaacaaccgtgtacgattgatac |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48561945 |
ctttccaattcactgcacaacagcaataacccaagggcactagtcttgcacttccactctcttcaagcaccacttttcaacaaccgtgtacgatagatac |
48561846 |
T |
 |
| Q |
231 |
ggcggtaatgttatttataatctaccaacatagattg |
267 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
48561845 |
ggcggcaatgttatttacaatttaccaacatagattg |
48561809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 331 - 503
Target Start/End: Complemental strand, 48561744 - 48561578
Alignment:
| Q |
331 |
cctgttagtagtaacaatttattggcagaagttaaactcaactgtctatctagaataagaaaggcaattagt---agtaactaatggtatccaaccgaac |
427 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
48561744 |
cctgttagtaataacaatttattggcagaagttaaactcaactgtctatctagaataagaaaggcaattagtagtagtaactaatgctatccaaccg--- |
48561648 |
T |
 |
| Q |
428 |
cccaacaacaccaactataataacaagaagaataattaactttttacacgggtagtgtaacgtttgtagtaatatt |
503 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48561647 |
------aacaccaactataataacaacaagaataatttactttttacacgggtagtgtaacgtttgtagtaatatt |
48561578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University