View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4228_low_11 (Length: 371)
Name: NF4228_low_11
Description: NF4228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4228_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 8e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 10 - 169
Target Start/End: Original strand, 28645447 - 28645606
Alignment:
| Q |
10 |
gcagagaagaaagggttcgatcggaaaaaccctagaaaatcccgcggagatgccgcgggaggttgaagatgaattcagcggcggaggtgaaagggatttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28645447 |
gcagagaagaaagggttcgatcggaaaaaccctagaaaatcccgcggagatgccgcgggaggttgaagatgaattcagcggcggaggtgagagggatttt |
28645546 |
T |
 |
| Q |
110 |
ggggaaattgagtgaaaatcgcaaaagattttgattttgtgagaatcgcttattgatcga |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28645547 |
ggggaaattgagtgaaaatcgcaaaagattttgattttgtgagaatcgcttattgatcga |
28645606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 329
Target Start/End: Original strand, 28645717 - 28645749
Alignment:
| Q |
297 |
gtaacaaataattcaattttatctttttccttc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
28645717 |
gtaacaaataattcaattttatcttttttcttc |
28645749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University