View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4228_low_19 (Length: 308)
Name: NF4228_low_19
Description: NF4228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4228_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 66 - 298
Target Start/End: Complemental strand, 45436186 - 45435954
Alignment:
| Q |
66 |
caaagctttaatagtaaccgnnnnnnncaaagctttaattatggacaactaattaactatttggctcatatgttgtttcactgtctaatactaacgacaa |
165 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45436186 |
caaagctttaatagtaaccgaaaaaaacaaagctttaattatggacaactaattaactatttggctcatatgttgtttcactgtctaatactaacgacaa |
45436087 |
T |
 |
| Q |
166 |
tgagtttattaaatctcattaacgtcacaactattccaccggcactgtatggtatggttatggtataatcacatcacatgtgcaatatttgtctgaacaa |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45436086 |
tgagtttattaaatctcattaacgtcacaactattccaccggcactgtatggtatggttatggtataatcacatcacatgtgcaatatttgtctgaacaa |
45435987 |
T |
 |
| Q |
266 |
aaatatagtccttgatttgctttcacttctctg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45435986 |
aaatatagtccttgatttgctttcacttctctg |
45435954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 51
Target Start/End: Complemental strand, 45436205 - 45436173
Alignment:
| Q |
19 |
atattctttcacttttaaacaaagctttaatag |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45436205 |
atattctttcacttttaaacaaagctttaatag |
45436173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University