View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4228_low_21 (Length: 272)
Name: NF4228_low_21
Description: NF4228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4228_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 24 - 225
Target Start/End: Complemental strand, 44448057 - 44447856
Alignment:
| Q |
24 |
atatgacaccaagctggaaacattctccaaaccactcactcaaagcaaacaggaagattaacttaatactaatacacataaataagccaaaagcataatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44448057 |
atatgacaccaagctggaaacattctccaaaccactcactcaaagcaaactggaagattaacttaatactaatacacataaataagccaaaagcataatt |
44447958 |
T |
|
| Q |
124 |
aattataagacaaagctaagcagaatgaatatctccataatatgcttgtgtgcttattatataattatattatacacatatgttcagccaaagaaatggt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44447957 |
aattataagacaaagctaagcagaatgaatatctccataatatgcttgtgtgcttattatataattatattatacacatatgttcagccaaagaaatggt |
44447858 |
T |
|
| Q |
224 |
gt |
225 |
Q |
| |
|
|| |
|
|
| T |
44447857 |
gt |
44447856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University