View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4228_low_24 (Length: 254)
Name: NF4228_low_24
Description: NF4228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4228_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 42163306 - 42163074
Alignment:
| Q |
1 |
cttgcaaaggaagcaaacacaattctggtaagatttttcaaattgatgcaataaatacttgtgcatttttaccacagtaattaaactgttggattcagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163306 |
cttgcaaaggaagcaaacacaattctggtaagatttttcaaattgatgcaataattacttgtgcatttttaccacagtaattaaactgttggattcagtg |
42163207 |
T |
|
| Q |
101 |
attttgattaatgaatgtgtttgatggacgatgatttgcagtttgattatcgaattccaacggctgaaaacgaaaagagtccactaccaatgaatgggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42163206 |
attttgattaatgaatgtgtttgatggacgatgatttgcagtttgattatcgaattccaacggctgaaaacgaaaagagtccactaccaatgaatgggct |
42163107 |
T |
|
| Q |
201 |
gccactaagcgcttattctccagagaccgtcgg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42163106 |
gccactaagcgcttattctccagagaccgtcgg |
42163074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 47171036 - 47171095
Alignment:
| Q |
102 |
ttttgattaatgaatgtgtttgatggacgatgatttgcagtttgattatcgaattccaacgg |
163 |
Q |
| |
|
|||| |||||| ||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
47171036 |
tttttattaatcaatgtgtttgatggacggtggt--gcagtttgattatcgaattccaacgg |
47171095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University