View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4229_high_13 (Length: 239)
Name: NF4229_high_13
Description: NF4229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4229_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 25613331 - 25613545
Alignment:
| Q |
1 |
ctcggattatagaatccaaaaatctcttgggcactttcgtnnnnnnntagggcacgtgagaaatgggtagggtgggaaaattaataatccacttattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
25613331 |
ctcggattatagaatccaaaaatctcttgggcactttcgtaaaaaaatagggcacgtgagaaatgggtagggtgggaaaattagtagtccacttattatt |
25613430 |
T |
|
| Q |
101 |
atgta-taagctattggcccactctacagtcaacaatgcacatgcttaaataaaggaagttggctagttcatttttgtacttattctattctgattcacg |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25613431 |
atgtactaagctattggcccactctacagtcaacaatgcacatgcttaaataaaggaagttggctagttcatttttgtacttattctattctgattcacg |
25613530 |
T |
|
| Q |
200 |
tttgagagagcacta |
214 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25613531 |
tttgagagagcacta |
25613545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 89
Target Start/End: Complemental strand, 26229931 - 26229898
Alignment:
| Q |
56 |
gtgagaaatgggtagggtgggaaaattaataatc |
89 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
26229931 |
gtgagaaatgggtagggtgggaaaagtaataatc |
26229898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 87
Target Start/End: Original strand, 237655 - 237691
Alignment:
| Q |
51 |
ggcacgtgagaaatgggtagggtgggaaaattaataa |
87 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
237655 |
ggcacgtgagaaatgggtagagtgggaaaagtaataa |
237691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University