View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4229_high_7 (Length: 334)
Name: NF4229_high_7
Description: NF4229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4229_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-176; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 32243759 - 32243436
Alignment:
| Q |
1 |
tgtagcttcttcaatcaaacctttaggtttatcactaccaatatcgacattaatattaccattgaaaacttctccagatgccataatttccaatgtgtca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243759 |
tgtagcttcttcaatcaaacctttaggtttagcactaccaatatcgacattaatattaccattgaaaacttctccagatgccataatttccaatgtgtca |
32243660 |
T |
|
| Q |
101 |
tgcacctcgccatcatgatttccaacataagaaaccacgagcttctgctttgtagccactagtctaatgtacccaaattcacccccacgatacaaagacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243659 |
tgcacctcgccatcatgatttccaacataagaaaccacgagcttctgctttgtagccactagtctaatgtacccaaattcacccccacgatacaaagacc |
32243560 |
T |
|
| Q |
201 |
gttttggttgtggaaagatcgagtcattgggatgacccggtcttgttttccagatggattgcttgtcttgccctgccatgccaatcacaagatgaacggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32243559 |
gttttggttgtggaaagatcgagtcattgggatgacccggtcttgttttccagatggattgcttgtcttgccctgccatgccaatcacaagatgaacggt |
32243460 |
T |
|
| Q |
301 |
atatcctctgtctcctgctctctg |
324 |
Q |
| |
|
||||||| |||||| ||||||||| |
|
|
| T |
32243459 |
atatcctttgtctcttgctctctg |
32243436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 67 - 302
Target Start/End: Complemental strand, 32248774 - 32248539
Alignment:
| Q |
67 |
aacttctccagatgccataatttccaatgtgtcatgcacctcgccatcatgatttccaacataagaaaccacgagcttctgctttgtagccactagtcta |
166 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||| | |||| |
|
|
| T |
32248774 |
aacttctccagattccagaatctccaatgtgtcatgcacctcgccatcatgattaccaacataagaaatcacgagattctgctttgtagccatcaatcta |
32248675 |
T |
|
| Q |
167 |
atgtacccaaattcacccccacgatacaaagaccgttttggttgtggaaagatcgagtcattgggatgacccggtcttgttttccagatggattgcttgt |
266 |
Q |
| |
|
||||| || || |||||||| || |||||||| ||||||||||||||| |||| | | ||| ||||||| ||||||||| | ||| |||| |||| || |
|
|
| T |
32248674 |
atgtatccgaactcacccccgcggtacaaagatcgttttggttgtggatagattgggacatcgggatgatccggtcttggtcgccacatgggttgccagt |
32248575 |
T |
|
| Q |
267 |
cttgccctgccatgccaatcacaagatgaacggtat |
302 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
32248574 |
cttgccctgccatgccgatcacaagatgaatggtat |
32248539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University