View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4229_low_18 (Length: 237)

Name: NF4229_low_18
Description: NF4229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4229_low_18
NF4229_low_18
[»] chr3 (1 HSPs)
chr3 (1-221)||(44836654-44836870)


Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 44836870 - 44836654
Alignment:
1 aatacgcttttgatagatgaacttaatcgtttggcttgtaaatgaaaatgttagaaatgct-tgatggccatgtggagagatgcttggcctactgcttgc 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
44836870 aatacgcttttgatagatgaacttaatcgtttggcttgtaaatgaaaatgttagaaatgccatgatggccatgtggagagatgcttggcctactgcttgc 44836771  T
100 cagtttttatggaagtaaagtagaacaataggagcattcatgactctttgcctccagactcctatattatataattggagggttattgctcatctttttt 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     ||||||||||||||||||||||||||||||||    
44836770 cagtttttatggaagtaaagtagaacaataggagcattcatgactctttgcctccagactcct-----atataattggagggttattgctcatctttttt 44836676  T
200 atagttgcttgaaaggggagag 221  Q
    ||||||||||||||||||||||    
44836675 atagttgcttgaaaggggagag 44836654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University