View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4229_low_20 (Length: 234)
Name: NF4229_low_20
Description: NF4229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4229_low_20 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 115 - 234
Target Start/End: Original strand, 13485479 - 13485598
Alignment:
| Q |
115 |
cgttgagcctcagagcaacattactaggccggcaaccttcaatagtattcacaatcttagtactcacaccttgattagcctctgtatgcttaatattttg |
214 |
Q |
| |
|
|||||| |||| ||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13485479 |
cgttgatcctcggagcaacattactaggcaggcaaccttccatagtattcacaatcttagtactcacaccttgattagcctctgtattcttaatattttg |
13485578 |
T |
 |
| Q |
215 |
attctcaaccaattcaattt |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13485579 |
gttctcaaccaattcaattt |
13485598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 7 - 83
Target Start/End: Original strand, 13485373 - 13485449
Alignment:
| Q |
7 |
ggacatcatcctcaacatttgactcagtatctcaagagggaacctgcttccgtggggattctagaggactcatgagg |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13485373 |
ggacatcatcctcaacatttgactcagtatctcaagagggaacctgcttccttggggattctagaggactcatgagg |
13485449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University