View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4230_high_20 (Length: 243)
Name: NF4230_high_20
Description: NF4230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4230_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 27 - 229
Target Start/End: Original strand, 12509009 - 12509210
Alignment:
| Q |
27 |
atttgtgcacgtatgtcttcaagtgtcttaacatttttaatacttatattgtgtgcttgatttgtacttgcaagttgatctcccttcaacttggatgagt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12509009 |
atttgtgcacgtatgtcttcaagtgtct-aacatttttaatacttatattgtgtgcttgatttgtacttgcaagttgatctcctttcaacttggatgagt |
12509107 |
T |
|
| Q |
127 |
ttatttggttagtgagaattcttccaacttggtaatatgtacactgttggtattttgggagaatctaaatcaatcattatattgaactaagaacaaatac |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12509108 |
ttatttggttagtgagaattcttccaacttggtaatatgtacactgttggtattttgggacaatctaaatcaatcattatattgaactaagaacaaatac |
12509207 |
T |
|
| Q |
227 |
aca |
229 |
Q |
| |
|
||| |
|
|
| T |
12509208 |
aca |
12509210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University