View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4230_high_24 (Length: 232)
Name: NF4230_high_24
Description: NF4230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4230_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 34 - 210
Target Start/End: Complemental strand, 22719405 - 22719230
Alignment:
| Q |
34 |
catatggtccaatctccaggggtgaagcagagacaattgtatgtctaggaatggtctggaaaaatccagacttttgcaacatgcactctaaataataccc |
133 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22719405 |
catatggtccaatctccaggggttaagcagagacaattgtatgtctaggaatggcatg-aaaaatccagacttttgcaacatgcactctaaataataccc |
22719307 |
T |
 |
| Q |
134 |
caccatgcgaggttaatatctgatcctaccagagtagacgctgatgttctagaatgaatgtgcgttttagcgagcga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22719306 |
caccatgcgaggttaatatctgatcctaccagagtagacgctgatgttctagaatgaatgtgcgttttagcgagcga |
22719230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University