View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4230_high_5 (Length: 459)
Name: NF4230_high_5
Description: NF4230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4230_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 156 - 447
Target Start/End: Original strand, 23405228 - 23405519
Alignment:
| Q |
156 |
ccctccgtctccgtgatgaccgtgatttccagctgaagttgtgtcaacaggagtcgttgctatagcagcagtcataaaaatcatgttaccatctttggca |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23405228 |
ccctccgtctccgtgatgaccgtgatttccagctgaagttgtgtcaacaggagtcgttgctatagcagcagtcataaaaatcatgttaccatctttggca |
23405327 |
T |
 |
| Q |
256 |
ccgctatcacctctatattttgtggcgctagctttagaagcatgcatggccttaaatcctccaccgttcttgtatgtgttattataatctcttttctttt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23405328 |
ccgctatcacctctatattttgtggcgctagctttagaagcatgcatggccttaaatcctccaccgttcttgtatgtgttattataatctcttttctttc |
23405427 |
T |
 |
| Q |
356 |
catgtcgtgagcaaaaacttcccatagctatatgttgttgggttcaatgatttagtttccgataaagctttcttatcctttatatatagtat |
447 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23405428 |
catgtcgtgagcaaaagtttcccatagctatatgttgttgggttcaaagatttagtttccgataaagctttcttatcctttatatatagtat |
23405519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 23405090 - 23405153
Alignment:
| Q |
18 |
atgtacagaaaaggtatggaccaagtcaataaaccgacattaatggcaaccatgatctcaaccg |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23405090 |
atgtacagaaaaggtatggaccaagtcaataaaccgacattaatggcaaccatgatctcaaccg |
23405153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University