View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4230_low_16 (Length: 368)

Name: NF4230_low_16
Description: NF4230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4230_low_16
NF4230_low_16
[»] chr2 (2 HSPs)
chr2 (11-152)||(43761195-43761336)
chr2 (228-350)||(43761412-43761534)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 11 - 152
Target Start/End: Original strand, 43761195 - 43761336
Alignment:
11 aatgagatgaacaaaaattgcatgaaaaaaggagggcattgtgcctttatcttggtttgaattgcagatattaactcaatcataacccacataacaccaa 110  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43761195 aatgaaatgaacaaaaattgcatgaaaaaaggagggcattgtgcctttatcttggtttgaattgcagatattaactcaatcataacccacataacaccaa 43761294  T
111 aacttttaactatggagttggagtgtgatcgcatttgtatct 152  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
43761295 aacttttaactatggagttggagtgtgatggcatttgtatct 43761336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 228 - 350
Target Start/End: Original strand, 43761412 - 43761534
Alignment:
228 tttgtatcttgcagatcaagaaaccaaggagtgtaacatggaaaacaaaataaaactgaaaacagatcattctctcaaacaaattggatctcatagtttt 327  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
43761412 tttgtatcttgcagatcaagaaaccaaggagtgtaacatggaaaacaaaataaaactgaaaacagatcattttctcaaacaaattggatctcatagtttt 43761511  T
328 ctttcctcttagaaactaattgt 350  Q
    |||||||||||||||||||||||    
43761512 ctttcctcttagaaactaattgt 43761534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University