View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4230_low_23 (Length: 310)
Name: NF4230_low_23
Description: NF4230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4230_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 37244678 - 37244408
Alignment:
| Q |
19 |
cttggagctctcttgcagatcgaataatataatcttcgtctggttcctcacaatttaacaaatttcttattggtggtctgagcgagggtgttgtgtggct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37244678 |
cttggagctctcttgcagatcgaataatataatcttcgtctggttcctcacaatttaacaaatttctcattggtggtctgagcgagggtgttgtgtggct |
37244579 |
T |
|
| Q |
119 |
tgcgttttcttgtatcatacttttcctgtacaagtccaatagatgcatacatttccccaaccttatgattttcttcttgaacaaggatgtattctcaatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
37244578 |
tgcgttttcttgtatcatacttttcctgtacaagtccaatagatgcgtacatttccccaaccttatgatttttgtcttgaacaaggatgtattcttaatg |
37244479 |
T |
|
| Q |
219 |
attccggatggccatgggtcaagaaattttatgattttcttgtttaacgactcacgatgatcttcctgtat |
289 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37244478 |
attcgggatggccatgggtcaagaaattttatgattttctcctttaacgactcacgatgatcttcctgtat |
37244408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 104 - 178
Target Start/End: Complemental strand, 37965258 - 37965184
Alignment:
| Q |
104 |
gggtgttgtgtggcttgcgttttcttgtatcatacttttcctgtacaagtccaatagatgcatacatttccccaa |
178 |
Q |
| |
|
|||||||| |||||||| | ||||||||||| ||||| || |||| |||||||| |||||| ||||||||||| |
|
|
| T |
37965258 |
gggtgttgggtggcttggttcttcttgtatcactctttttctatacacgtccaatacatgcatgcatttccccaa |
37965184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University