View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4230_low_28 (Length: 237)
Name: NF4230_low_28
Description: NF4230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4230_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 34930430 - 34930652
Alignment:
| Q |
1 |
aaaagactcgtacattctcacgtgtctcttgaaattgaacttttttatccatcaattatgacatttgtgacaattttggtccaactggtattattagtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34930430 |
aaaagactcgtacattctcacgtgtctcttaaaattgaacttttttatccatcaattatgacatttgtgacaattttggttcaactggtattattagtct |
34930529 |
T |
 |
| Q |
101 |
nnnnnnnngtgatttttgaggtcaaaattcaa-nnnnnnngggggtaacatcattatttttgggaccaaaattcatggttagaaaccaaaatgacaacaa |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34930530 |
aaaaaaaagtgatttttgaggtcaaaattcaatttttttggggggtaacatcattatttttgggaccaaaattcatggttagaaaccaaaatgacaacaa |
34930629 |
T |
 |
| Q |
200 |
atataatgatggttgaattgaat |
222 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
34930630 |
atgtaatgatggttgaattgaat |
34930652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University