View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4230_low_31 (Length: 232)

Name: NF4230_low_31
Description: NF4230
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4230_low_31
NF4230_low_31
[»] chr7 (1 HSPs)
chr7 (34-210)||(22719230-22719405)


Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 34 - 210
Target Start/End: Complemental strand, 22719405 - 22719230
Alignment:
34 catatggtccaatctccaggggtgaagcagagacaattgtatgtctaggaatggtctggaaaaatccagacttttgcaacatgcactctaaataataccc 133  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||  || |||||||||||||||||||||||||||||||||||||||||    
22719405 catatggtccaatctccaggggttaagcagagacaattgtatgtctaggaatggcatg-aaaaatccagacttttgcaacatgcactctaaataataccc 22719307  T
134 caccatgcgaggttaatatctgatcctaccagagtagacgctgatgttctagaatgaatgtgcgttttagcgagcga 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22719306 caccatgcgaggttaatatctgatcctaccagagtagacgctgatgttctagaatgaatgtgcgttttagcgagcga 22719230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University