View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4231_low_2 (Length: 291)
Name: NF4231_low_2
Description: NF4231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4231_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 42523752 - 42523972
Alignment:
| Q |
16 |
aatagccgttctcatggccaacat---ctctaaacattataagatgggggttccaatctgatgaggtggatttggcgtgtcacactgtcaccatgacttc |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42523752 |
aatagccgttctcatggccaacatgatctctaaacattataagatgggggttccaatctgatgaggtggatttggcgtgtcacactgtcaccatgacttc |
42523851 |
T |
 |
| Q |
113 |
ttattagcctacataacatgattcagacttcattctgttgaccccacactaccatgtgaaactcagacccaccccctgattctgattctgattctgtgca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42523852 |
ttattagcctacataacatgattcagacttcattctgttgaccccacactaccatgtgaaactcagacccacccc------------ctgattctgtgca |
42523939 |
T |
 |
| Q |
213 |
aggaatgtactactctatgataatcaactagcc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42523940 |
aggaatgtactactctatgataatcaactagcc |
42523972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University