View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4231_low_5 (Length: 248)
Name: NF4231_low_5
Description: NF4231
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4231_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 42591812 - 42592043
Alignment:
| Q |
1 |
ttggcagagttcactcctgtattctttagagtcttcaaagctccaagtaaacatgtagttctcttgtgctctgatgccacgaggtatgagtaatttaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42591812 |
ttggcagagttcactcctgtattctttagagtcttcaaagctccaagtaaacatgtagttctcttgtgctctgatgccacgaggtatgagtaatttaaat |
42591911 |
T |
 |
| Q |
101 |
tggaataacctatcagtttagttttaaaatatcactctcttttcaatttactttctaaaatatatatnnnnnnnttgaacatccttaaagtatatgaaat |
200 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42591912 |
tagaataacctatcagttttgttttaaaatatcactctcttttcaatttactttctaaaatatatattaaaaaattgaacatccttaaagtatatgaaat |
42592011 |
T |
 |
| Q |
201 |
caatgaagttagtctctagtgtatattatatt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42592012 |
caatgaagttagtctctagtgtatattatatt |
42592043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 77
Target Start/End: Complemental strand, 25951326 - 25951262
Alignment:
| Q |
13 |
actcctgtattctttagagtcttcaaagctccaagtaaacatgtagttctcttgtgctctgatgc |
77 |
Q |
| |
|
|||||||| ||||||||| | ||||||||| ||| |||||| || ||||| ||||||||||||| |
|
|
| T |
25951326 |
actcctgtgttctttagaattttcaaagcttcaaataaacacgtgattctcatgtgctctgatgc |
25951262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University