View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4232_low_13 (Length: 282)
Name: NF4232_low_13
Description: NF4232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4232_low_13 |
 | |
|
| [»] scaffold0046 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 23458436 - 23458690
Alignment:
| Q |
19 |
ggtttaatttcagatatagaaactgaaactttctttagggctttatcaaacccagctttgtggtgcattggaatttcatccctcaattcttcaattttag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23458436 |
ggtttaatttcagatatagaaactgaaactttctttagggctttatcaaacccagctttgtggtgcattggaatttcatccctcgattcttcaattttag |
23458535 |
T |
|
| Q |
119 |
ccttcaactcttcaatttcagccgtcaaatctttagtttcaagctccttcttttcgacaatgtattctttgatgtttagttttattttaatcttggtatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23458536 |
ccttcaactcttcaatttcagccgtcaaatctttagtttcaagctccttcttttcgacaatgtcttctttgatgtttagttttattttaatcttggtatt |
23458635 |
T |
|
| Q |
219 |
ttcctccatcaaaccttctactctttccactaactcactcttttgcaagaataat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23458636 |
ttcctccatcaaaccttctactctttccactaactcactcttttgcaagaataat |
23458690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 135
Target Start/End: Original strand, 23462316 - 23462431
Alignment:
| Q |
20 |
gtttaatttcagatatagaaactgaaactttctttagggctttatcaaacccagctttgtggtgcattggaatttcatccctcaattcttcaattttagc |
119 |
Q |
| |
|
|||||| ||||||||| |||||| ||| || ||| | || |||||||||||||| |||| |||| |||||||||| || ||| |||||||||| ||| |
|
|
| T |
23462316 |
gtttaagttcagatattgaaactaaaatttgcttgactgccttatcaaacccagcattgtactgcactggaatttcagccttcacctcttcaatttcagc |
23462415 |
T |
|
| Q |
120 |
cttcaactcttcaatt |
135 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
23462416 |
tttcaaatcttcaatt |
23462431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0046 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0046
Description:
Target: scaffold0046; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 74565 - 74638
Alignment:
| Q |
61 |
ttatcaaacccagctttgtggtgcattggaatttcatccctcaattcttcaattttagccttcaactcttcaat |
134 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||| | ||| |||||||||| ||| ||||| |||||||| |
|
|
| T |
74565 |
ttatcaaacccagcattgtgctgcactggaatttcagtcttcacctcttcaatttcagctttcaaatcttcaat |
74638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University