View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4232_low_14 (Length: 273)
Name: NF4232_low_14
Description: NF4232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4232_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 72 - 259
Target Start/End: Original strand, 10805294 - 10805481
Alignment:
| Q |
72 |
caaaacttgaatttaaggtaatcacaatcacaattcacaacttgttgaaaataatgtgattgaactgttacacggatctagaggatatttaatattaacg |
171 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10805294 |
caaaacttaaatttaaggtaatcacaatcacaattcacaacttgttgaaaataatgtgattgaactgttacacggatctagaggatatttaatattaacg |
10805393 |
T |
|
| Q |
172 |
agaaactaggaaatgcatatgaaaataaaatttaaaaacatgcatgatgtatcctacaaagtacagacacataatgttctcacttttg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10805394 |
agaaactaggaaatgcatatgaaaataaaatttaaaaacatgcatgatgtatactacaaagtacagacacataatgttctcacttttg |
10805481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 50
Target Start/End: Original strand, 10805225 - 10805261
Alignment:
| Q |
14 |
attattctagtgattgcttagtaaggtacttactttc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10805225 |
attattctagtgattgcttagtaaggtacttactttc |
10805261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University