View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4232_low_19 (Length: 241)
Name: NF4232_low_19
Description: NF4232
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4232_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 230
Target Start/End: Complemental strand, 21437771 - 21437562
Alignment:
| Q |
21 |
ggaacacttcaatcccactttgtcaatggagaggactcaaatgggtcttcacaaacggttcatcactttcatgcactgacttatcttcacctcaatggaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21437771 |
ggaacacttcaatcccactttgtcaatggagaggactcaaatgggtcttcacaaacggttcatcactttcatgcactgacttatcttcaccacaatggaa |
21437672 |
T |
 |
| Q |
121 |
caatcttttattcttcaaaaacccttttttgcatttgttttctattcaactaccttctgcaaatctctctggttctctccctagagagattggtcagttt |
220 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21437671 |
caatctttcattcttcaaaaacccttttttgcatttgttttctcttcaactaccttctgcaaatctctctggttctctccctagagagattggtcagttt |
21437572 |
T |
 |
| Q |
221 |
cctatgcttc |
230 |
Q |
| |
|
|||||||||| |
|
|
| T |
21437571 |
cctatgcttc |
21437562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University