View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4233_high_4 (Length: 305)

Name: NF4233_high_4
Description: NF4233
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4233_high_4
NF4233_high_4
[»] chr5 (1 HSPs)
chr5 (53-305)||(30968026-30968260)


Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 53 - 305
Target Start/End: Complemental strand, 30968260 - 30968026
Alignment:
53 cagttttcagactctggctttttcagtaatagagaagatcctgctacttatgaggaagctgcaaagttcaattgttggaaagaggctatggatcaggaaa 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30968260 cagttttcagactctggctttttcagtaatagagaagatcctgctacttatgaggaagctgcaaagttcaattgttggaaagaggctatggatcaggaaa 30968161  T
153 ttgaagccatagaaagaaatgatacatgggaactaactgatttaccaactggaagcaggaagattagtgtaaaatggatttataagac--aatacaatga 250  Q
    ||||||||||||||||||||||                    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
30968160 ttgaagccatagaaagaaatga--------------------taccaactggaagcaggaagattagtgtaaaatggatttataagacaaaatacaatga 30968081  T
251 aaatggtaaagttgaaaaacacaaagccagattagtagcaaaggggtactctcaa 305  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30968080 aaatggtaaagttgaaaaacacaaagccagattagtagcaaaggggtactctcaa 30968026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University