View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4234_high_13 (Length: 217)
Name: NF4234_high_13
Description: NF4234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4234_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 59 - 205
Target Start/End: Original strand, 6643996 - 6644143
Alignment:
| Q |
59 |
aagatttaaaaccaaaacat-attctaagggacgggattcgactcttttgatgcatttaggtttttcttcttacaaatagagctcatagaacaaatcgta |
157 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6643996 |
aagatttaaaaccaaaacatgattctaagggacgggattcgactcttttgatgcatttaggtttttcttcttacaaatagagctcatagaacaaatcgta |
6644095 |
T |
 |
| Q |
158 |
agatttatttacttaagattaagaatttaagatgtgtgcttattgatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6644096 |
agatttatttacttaagattaagaatttaagatgtgtgcttattgatg |
6644143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 13 - 61
Target Start/End: Original strand, 6643890 - 6643938
Alignment:
| Q |
13 |
caaaggagaaagtagagtatgtcgctttcaatcactaaaatggctgaag |
61 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||| |||||| |
|
|
| T |
6643890 |
caaaggagaaagtagagtatgtcactttcaatcaccaaaatgtctgaag |
6643938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University