View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4234_low_10 (Length: 244)
Name: NF4234_low_10
Description: NF4234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4234_low_10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 244
Target Start/End: Complemental strand, 38285139 - 38284915
Alignment:
| Q |
15 |
atatgttaattgtttcatttcttttagttgacatataca--ccacacaaaacagtagagaatatannnnnnnattaattgataaaattgaagaaaggaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38285139 |
atatgttaattgtttcatttcttttagttgaaatatatataccacacaaaacagtagagaatata--------tta---gataaaattgaagaaaggaaa |
38285051 |
T |
|
| Q |
113 |
aaactcagttgcaattacaaacaccgcgccatatgca----tctagtaaaagaaaccatatagacatgtagtggtacttatttaggtccaagtccaaatt |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38285050 |
aaactcagttgcaattgcaaacaccgcgccatatgcacgcatctagtaaaagaaaccatatagacatgtagtggtacttatttaggtccaagtccaaatt |
38284951 |
T |
|
| Q |
209 |
ctaattacatagtagtatgttggtggaaggtggatg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38284950 |
ctaattacatagtagtatgttggtggaaggtggatg |
38284915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University