View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4234_low_11 (Length: 240)
Name: NF4234_low_11
Description: NF4234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4234_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 34035991 - 34035847
Alignment:
| Q |
1 |
ctctatttgttttcaattcctctttttatccgactcatttaaattttgaaattcattgtattttgccagcatacactctagaaaaacatacctcttatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34035991 |
ctctatttgttttcaattcctctttttatccgactcatttaaattttgaaattcattgtattttgccagcatacactctagaaaaacatacctcttatta |
34035892 |
T |
 |
| Q |
101 |
tttcacatccttttctagaagcaacaatatatacatccctaactt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34035891 |
tttcacatccttttctagaagcaacaatatatacatccctaactt |
34035847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 161 - 237
Target Start/End: Complemental strand, 34035862 - 34035786
Alignment:
| Q |
161 |
tatacatccctaacttatcattggtaaactggttttgattattagttcgaatctcacttcaaaaaatatatattcat |
237 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34035862 |
tatacatccctaacttatcattggtgaactggttttgattattagttcgaatctcacttcaaaaaatatatattcat |
34035786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University