View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4235_high_6 (Length: 266)
Name: NF4235_high_6
Description: NF4235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4235_high_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 7665059 - 7665309
Alignment:
| Q |
16 |
gcacattgagagaagggtgggtgagtaaccgtttgaagaaaatttacccaaagtgggaccactttgtgagaaagtaaggggtatatgaggaaagagaaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665059 |
gcacattgagagaagggtgggtgagtaaccgtttgaagaaaatttacccaaggtgggaccactttgtgagaaagtaaggggtatatgaggaaagagaaga |
7665158 |
T |
|
| Q |
116 |
atcaaatagtggtgtgcaatatgttgtgatttcatcattctcttctattgactagtctattgaagaaagaggcatttgcatggactgaagatgctcaaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7665159 |
atcaaatagtggtgtgcaatatgttgtgatttcatcattctcttctattgactaatctattgaagaaagaggcatttgcatggactgaagatgctcaaac |
7665258 |
T |
|
| Q |
216 |
aacttttgttaaattgaagcatgtcttaagtcttaactacaacccctgtac |
266 |
Q |
| |
|
| |||||| |||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
7665259 |
agcttttgataaattgaagcaggtcctaagtcttaactacaacccctgtac |
7665309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University