View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4235_low_11 (Length: 206)
Name: NF4235_low_11
Description: NF4235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4235_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 124 - 184
Target Start/End: Original strand, 40115734 - 40115794
Alignment:
| Q |
124 |
gatacaatgaagtgacatatttatattttatagtcctctaactagagtggtaactaacctt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40115734 |
gatacaatgaagtgacatatttatattttatagtcctctaactagagtggtaattaacctt |
40115794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 11 - 67
Target Start/End: Original strand, 40115619 - 40115675
Alignment:
| Q |
11 |
cataggacaaagatcatagatgtaaataagatagagaacatatatgtattgatgagg |
67 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
40115619 |
cataggacaaagatcatagatgtaaacatgatagagaacaaatatgtattgatgagg |
40115675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University