View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4235_low_11 (Length: 206)

Name: NF4235_low_11
Description: NF4235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4235_low_11
NF4235_low_11
[»] chr8 (2 HSPs)
chr8 (124-184)||(40115734-40115794)
chr8 (11-67)||(40115619-40115675)


Alignment Details
Target: chr8 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 124 - 184
Target Start/End: Original strand, 40115734 - 40115794
Alignment:
124 gatacaatgaagtgacatatttatattttatagtcctctaactagagtggtaactaacctt 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
40115734 gatacaatgaagtgacatatttatattttatagtcctctaactagagtggtaattaacctt 40115794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 11 - 67
Target Start/End: Original strand, 40115619 - 40115675
Alignment:
11 cataggacaaagatcatagatgtaaataagatagagaacatatatgtattgatgagg 67  Q
    |||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||    
40115619 cataggacaaagatcatagatgtaaacatgatagagaacaaatatgtattgatgagg 40115675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University