View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4235_low_7 (Length: 280)
Name: NF4235_low_7
Description: NF4235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4235_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 14 - 221
Target Start/End: Original strand, 3737355 - 3737562
Alignment:
| Q |
14 |
aatttgtgccaatagtttctttaggatctaaaagatgacagaagtttatttgacaagaaatcaaatagtttgaaggttgtatgtaagggtgagaatatat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3737355 |
aatttgtgccaatagtttctttaggatctaaaagatgacagaagtttatttgacaagaaatcaaatagtttgaaggttgtatgtaagggtgagaatagac |
3737454 |
T |
 |
| Q |
114 |
cagaccaaccgacatgagtctgcgatctatcatacgagatgtctagcttgtctagcctgaattnnnnnnnttagaccccattatcttggggtggtggggg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
3737455 |
cagaccaaccgacatgagtctgcgatctatcatacgacatgtctagcctgtctagcctgaattaaaaaaattagaccccattatcttggagtggtggggg |
3737554 |
T |
 |
| Q |
214 |
gtatgaat |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
3737555 |
gtatgaat |
3737562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 66 - 110
Target Start/End: Original strand, 3740876 - 3740920
Alignment:
| Q |
66 |
acaagaaatcaaatagtttgaaggttgtatgtaagggtgagaata |
110 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
3740876 |
acaagaaatcaaataatttgaaggttatatgtaagggtgataata |
3740920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University